reporter vector pcpg free promoter lucia  (InvivoGen)

Journal: American Journal of Physiology - Gastrointestinal and Liver Physiology

Article Title: Epigenetic modulation of intestinal Na + /H + exchanger-3 expression

doi: 10.1152/ajpgi.00293.2017

Figure Lengend Snippet: Effect of DNA methylation on Na+/H+ exchanger-3 (NHE3) promoter activity in Caco-2 cells. A: human (h) NHE3 promoter region flanking the area between −1509 and +127 (+1 is the transcription initiation site) was amplified by PCR and cloned in a promoterless cytosine guanine dinucleotide (CpG)-free vector upstream of the lucia gene (pCpG-EV). B: CpG-free EF1 promoter lucia vector (pCpG- hEF1) was used as control for methylation. The NHE3 promoter construct (pCpG-NHE3) and the control vector (pCpG- hEF1) were subjected to in vitro DNA methylation. The methylated and unmethylated control vector and NHE3 promoter construct were transiently transfected in Caco-2 cells along with the mammalian expression vector of β-galactosidase. Posttransfection (48 h), cells were harvested, and lucia activity and β-galactosidase activity were measured. The relative promoter activity was determined as a ratio of lucia to β-galactosidase. Results represent means ± SE of 3–4 separate experiments and are expressed as % of control comparing methylated control vector (pCpG-hEF1 methylated) or methylated NHE3 promoter construct (pCpG-NHE3 methylated) with unmethylated control vector (pCpG-hEF1) or unmethylated NHE3 promoter construct (pCpG-NHE3). **P < 0.01 compared with unmethylated vector/construct as assessed by Student's t-test. C: effect of 5-azacytidine on DNA methylation in the promoter region of NHE3 in Caco-2 cells: DNA was extracted from Caco-2 cells treated with or without 5-azacytidine (10 μM) for 48 h. DNA methylation was determined by qPCR after MethyMiner precipitation using specific primers described in materials and methods, normalized to DNA input, and expressed as fold change. Results represent means ± SE of 3–4 separate experiments. **P < 0.01 compared with untreated cells (control) as assessed by Student's t-test.

Article Snippet: A pCpG-free lucia vector with EF1 promoter (Invivogen) was used as a control for the methylation experiment.

Techniques: DNA Methylation Assay, Activity Assay, Amplification, Clone Assay, Plasmid Preparation, Methylation, Construct, In Vitro, Transfection, Expressing

Journal: American Journal of Physiology - Gastrointestinal and Liver Physiology

Article Title: Epigenetic modulation of intestinal Na + /H + exchanger-3 expression

doi: 10.1152/ajpgi.00293.2017

Figure Lengend Snippet: Effect of DNA methylation on Na+/H+ exchanger-3 (NHE3) promoter activity in Caco-2 cells. A: human (h) NHE3 promoter region flanking the area between −1509 and +127 (+1 is the transcription initiation site) was amplified by PCR and cloned in a promoterless cytosine guanine dinucleotide (CpG)-free vector upstream of the lucia gene (pCpG-EV). B: CpG-free EF1 promoter lucia vector (pCpG- hEF1) was used as control for methylation. The NHE3 promoter construct (pCpG-NHE3) and the control vector (pCpG- hEF1) were subjected to in vitro DNA methylation. The methylated and unmethylated control vector and NHE3 promoter construct were transiently transfected in Caco-2 cells along with the mammalian expression vector of β-galactosidase. Posttransfection (48 h), cells were harvested, and lucia activity and β-galactosidase activity were measured. The relative promoter activity was determined as a ratio of lucia to β-galactosidase. Results represent means ± SE of 3–4 separate experiments and are expressed as % of control comparing methylated control vector (pCpG-hEF1 methylated) or methylated NHE3 promoter construct (pCpG-NHE3 methylated) with unmethylated control vector (pCpG-hEF1) or unmethylated NHE3 promoter construct (pCpG-NHE3). **P < 0.01 compared with unmethylated vector/construct as assessed by Student's t-test. C: effect of 5-azacytidine on DNA methylation in the promoter region of NHE3 in Caco-2 cells: DNA was extracted from Caco-2 cells treated with or without 5-azacytidine (10 μM) for 48 h. DNA methylation was determined by qPCR after MethyMiner precipitation using specific primers described in materials and methods, normalized to DNA input, and expressed as fold change. Results represent means ± SE of 3–4 separate experiments. **P < 0.01 compared with untreated cells (control) as assessed by Student's t-test.

Article Snippet: For the construction of pCpG-free NHE3 vector, the DNA fragment containing the −1509/+127 region of the human NHE3 promoter was amplified using sense 5′-ATCGATGCGAGTACT GTCAGAAGACACATCCATCC -3′ and antisense 5′-ATCGATGCGAAGCTT CCCGAGTCCCCACATTGCCG -3′ primers, and the amplified promoter fragments were then inserted in a promoterless CpG-free vector (pCpG-free basic lucia; InvivoGen, San Diego, CA) upstream of the lucia reporter gene ( 23 ).

Techniques: DNA Methylation Assay, Activity Assay, Amplification, Clone Assay, Plasmid Preparation, Control, Methylation, Construct, In Vitro, Transfection, Expressing

Journal: American Journal of Physiology - Gastrointestinal and Liver Physiology

Article Title: Epigenetic modulation of intestinal Na + /H + exchanger-3 expression

doi: 10.1152/ajpgi.00293.2017

Figure Lengend Snippet: 5-Azacytidine increases NHE3 expression in Caco-2 and HuTu 80 cells. A: Caco-2 cells grown on filter support were treated with 5-azacytidine (10 μM) for 24 or 48 h. Total RNA was then extracted from the untreated or treated cells. NHE3 mRNA expression was assessed by qRT-PCR. The relative abundance of NHE3 mRNA was normalized to GAPDH mRNA (internal control). The data were expressed as fold increase in arbitrary units compared with untreated control that is set as 1. Results represent means ± SE of 4 independent experiments. *P < 0.05 and **P < 0.01 compared with untreated cells (control) as assessed by Student's t-test. B: total lysates were prepared from untreated or 5-azacytidine treated (10 μM, 24 h) cells. Extracted proteins (75 μg) were subjected to Western blot analysis on 7.5% SDS-PAGE using specific NHE3 antibody. The blots were stripped and reprobed with GAPDH antibody to indicate equal loading of protein in each lane. A representative blot of 3 different experiments is shown. The data were quantified by densitometric analysis, expressed as arbitrary units, and represent means ± SE of 3 separate experiments. *P < 0.05 compared with untreated control as assessed by Student's t-test. C: HuTu 80 cells were treated with 5-azacytidine (10 μM) for 48 h. Cells were then harvested, and RNA was isolated. NHE3 mRNA expression relative to GAPDH mRNA expression was assessed by qRT-PCR. The relative abundance of NHE3 mRNA was normalized to GAPDH mRNA (internal control). The data were expressed as fold increase in arbitrary units compared with untreated control that is set as 1. Results represent means ± SE of 3 independent experiments. **P < 0.01 compared with untreated cells (control) as assessed by Student's t-test.

Article Snippet: For the construction of pCpG-free NHE3 vector, the DNA fragment containing the −1509/+127 region of the human NHE3 promoter was amplified using sense 5′-ATCGATGCGAGTACT GTCAGAAGACACATCCATCC -3′ and antisense 5′-ATCGATGCGAAGCTT CCCGAGTCCCCACATTGCCG -3′ primers, and the amplified promoter fragments were then inserted in a promoterless CpG-free vector (pCpG-free basic lucia; InvivoGen, San Diego, CA) upstream of the lucia reporter gene ( 23 ).

Techniques: Expressing, Quantitative RT-PCR, Control, Western Blot, SDS Page, Isolation

Journal: American Journal of Physiology - Gastrointestinal and Liver Physiology

Article Title: Epigenetic modulation of intestinal Na + /H + exchanger-3 expression

doi: 10.1152/ajpgi.00293.2017

Figure Lengend Snippet: Small-interfering RNA (siRNA)-mediated knockdown of growth arrest and DNA damage-inducible 45b (GADD45b) decreases NHE3 expression in Caco-2 cells. Caco-2 cells were transfected with scrambled siRNA (control) or specific GADD45b siRNA. Cells were then harvested 72 h posttransfection, and total RNA was extracted. GADD45b mRNA (A) or NHE3 mRNA (B) expression in scrambled (control) or GADD45b siRNA-treated cells was assessed by qRT-PCR relative to GAPDH mRNA expression (internal control). NHE3 mRNA expression with respect to silencing of GADD45b was assessed by qRT-PCR relative to GAPDH expression. The data were expressed as fold change in arbitrary units compared with untreated control that is set as 1. Results represent means ± SE of 3 independent experiments. **P < 0.01 compared with scrambled siRNA-treated cells (control) as assessed by Student's t-test.

Article Snippet: For the construction of pCpG-free NHE3 vector, the DNA fragment containing the −1509/+127 region of the human NHE3 promoter was amplified using sense 5′-ATCGATGCGAGTACT GTCAGAAGACACATCCATCC -3′ and antisense 5′-ATCGATGCGAAGCTT CCCGAGTCCCCACATTGCCG -3′ primers, and the amplified promoter fragments were then inserted in a promoterless CpG-free vector (pCpG-free basic lucia; InvivoGen, San Diego, CA) upstream of the lucia reporter gene ( 23 ).

Techniques: Small Interfering RNA, Knockdown, Expressing, Transfection, Control, Quantitative RT-PCR

Journal: American Journal of Physiology - Gastrointestinal and Liver Physiology

Article Title: Epigenetic modulation of intestinal Na + /H + exchanger-3 expression

doi: 10.1152/ajpgi.00293.2017

Figure Lengend Snippet: 5-Azacytidine increases NHE3 expression in mouse ileum and colon. 5-Azacytidine (10 mg/kg body wt) was administered to mice by ip injections (3 injections/wk for 3 wk), and the ileum and colon were harvested. Total RNA was extracted from the mucosal scrapings of ileum and colon, and NHE3 mRNA expression was assessed by qRT-PCR. A: the relative abundance of NHE3 mRNA was normalized to GAPDH mRNA (internal control). The data were expressed as fold increase in arbitrary units compared with untreated control. Results represent means ± SE of each animal group (n = 4–6 animals/group). *P < 0.05 and ***P < 0.001 compared with untreated mice (control) as assessed by Student's t-test. Total protein lysates were prepared from the mucosal scrapings of ileum (B) or colon (C) of untreated or 5-azacytidine-treated mice. Extracted proteins (75 μg) were subjected to Western blot analysis on 7.5% SDS-PAGE using specific NHE3 antibody. The blots were stripped and reprobed with GAPDH antibody to indicate equal loading of protein in each lane. A representative blot is shown. The data were quantified by densitometric analysis, expressed as arbitrary units, and represent means ± SE of each animal group (n = 4–6 animals/group). *P < 0.05 and **P < 0.01 compared with untreated control as assessed by Student's t-test. D: immunostaining of NHE3 protein in the colon of untreated (control) and 5-azacytidine-treated mice. Green, NHE3; red, villin; blue, nuclei; scale bar = 20 μm. Representative image is shown.

Article Snippet: For the construction of pCpG-free NHE3 vector, the DNA fragment containing the −1509/+127 region of the human NHE3 promoter was amplified using sense 5′-ATCGATGCGAGTACT GTCAGAAGACACATCCATCC -3′ and antisense 5′-ATCGATGCGAAGCTT CCCGAGTCCCCACATTGCCG -3′ primers, and the amplified promoter fragments were then inserted in a promoterless CpG-free vector (pCpG-free basic lucia; InvivoGen, San Diego, CA) upstream of the lucia reporter gene ( 23 ).

Techniques: Expressing, Quantitative RT-PCR, Control, Western Blot, SDS Page, Immunostaining

Journal: American Journal of Physiology - Gastrointestinal and Liver Physiology

Article Title: Epigenetic modulation of intestinal Na + /H + exchanger-3 expression

doi: 10.1152/ajpgi.00293.2017

Figure Lengend Snippet: Loss of GADD45b decreases NHE3 expression in mouse ileum and colon. Age-matched (10–12 wk) wild-type (WT) and GADD45b KO mice were used for mRNA expression and immunofluorescence studies. Total RNA was extracted from the mucosal scrapings of ileum and colon, and NHE3 mRNA expression was assessed by qRT-PCR. A: the relative abundance of NHE3 mRNA was normalized to GAPDH mRNA (internal control). The data were expressed as fold decrease in arbitrary units compared with WT mice. Results represent means ± SE of each animal group (n = 4–6 animals/group). ***P < 0.001 compared with WT mice as assessed by Student's t-test. B: total protein lysates were prepared from the mucosal scrapings of ileum of WT or GADD45b KO mice. Extracted proteins (75 μg) were subjected to Western blot analysis on 7.5% SDS-PAGE using specific NHE3 antibody. The blots were stripped and reprobed with GAPDH antibody to indicate equal loading of protein in each lane. A representative blot is shown. The data were quantified by densitometric analysis, expressed as arbitrary units, and represent means ± SE of each animal group (n = 4–6 animals/group). *P < 0.05 compared with WT as assessed by Student's t-test. Immunostaining of NHE3 protein in the ileum (C) and colon (D) of WT and GADD45b KO mice. Green, NHE3; red, villin; blue, nuclei; scale bar = 20 μm. Representative images are shown.

Article Snippet: For the construction of pCpG-free NHE3 vector, the DNA fragment containing the −1509/+127 region of the human NHE3 promoter was amplified using sense 5′-ATCGATGCGAGTACT GTCAGAAGACACATCCATCC -3′ and antisense 5′-ATCGATGCGAAGCTT CCCGAGTCCCCACATTGCCG -3′ primers, and the amplified promoter fragments were then inserted in a promoterless CpG-free vector (pCpG-free basic lucia; InvivoGen, San Diego, CA) upstream of the lucia reporter gene ( 23 ).

Techniques: Expressing, Immunofluorescence, Quantitative RT-PCR, Control, Western Blot, SDS Page, Immunostaining